View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20346_low_7 (Length: 420)
Name: NF20346_low_7
Description: NF20346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20346_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 15 - 318
Target Start/End: Original strand, 49862076 - 49862370
Alignment:
| Q |
15 |
atgaaccagtctgtatcggaattttcttcttcttgttcttcctcatgttctgatgagaagcaatcttcattggttgacattaccgttgagattccgagaa |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49862076 |
atgaaccggtctgtatcggaattttcttcttcttgttcttcctcatgttctgatgagaagcaatcttcatcggttgacattaccgttgagattccgagaa |
49862175 |
T |
|
| Q |
115 |
ggagtgaatccgattgcaagagttttgctgtgggagagtcgagttgtgattcaccatcatcgtttcggtcaccaatgagtcgtgttttgtcgttcacgag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862176 |
ggagtgaatccgattgcaagagttttgctgtgggagagtcgagttgtgattcaccatcatcgtttcggtcaccaatgagtcgtgttttgtcgttcacgag |
49862275 |
T |
|
| Q |
215 |
aatccttagcagagagaggaaaccaagcatttctccgtcgttggattgtgccgcagatgcagaatgaggtgaaagggaggagactcagtgagttgattga |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49862276 |
aatccttagcagagagaggaaaccaagcatttctccgtcgttggattg---------tgcagaacgaggtgaaagggaggagactcggtgagttgattga |
49862366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University