View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_high_23 (Length: 266)
Name: NF20347_high_23
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_high_23 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 148 - 266
Target Start/End: Complemental strand, 21137193 - 21137075
Alignment:
| Q |
148 |
ataactatctattaccaatattgtattttctttgaaactctcaattgttaacatagaaaggataagagtgacatcgccaagcatgttataacaattgaaa |
247 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21137193 |
ataactatctattgccaatattgtattttctttgaaactctcaattgtcaacatagaaaggataagagtgacatcgccaagcatgttataacaattgaaa |
21137094 |
T |
 |
| Q |
248 |
tatatttatatattaatta |
266 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
21137093 |
tatatttatatattaatta |
21137075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 31 - 120
Target Start/End: Complemental strand, 21137376 - 21137287
Alignment:
| Q |
31 |
gttagatataaaacattcatgcatttctaaataacacaacttaagtttttggaatggtgcttgaacatgtgaccacttggccaaagaaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21137376 |
gttagatataaaacattcatgcatttctaaataacacaacttaagtttttggaatggtgcttgaacatgtgaccacttggccaaagaaag |
21137287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University