View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_low_16 (Length: 317)
Name: NF20347_low_16
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 9 - 302
Target Start/End: Original strand, 7715603 - 7715896
Alignment:
| Q |
9 |
gaagaatatccccgtcaacaacataataactggaccactaaaatcccaatttaccaagctaaaaaggtgtatggtctcgatgggatctaatttgaaccca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7715603 |
gaagaatatccccgtcaacaacataataactggaccactaaaatcccaatttaccaagctaaaaaggtgtatggtctcgatgggatctaatttgaaccca |
7715702 |
T |
 |
| Q |
109 |
aaaggaaaaataaaaatatccctaacccctactaagacaaacattccagttgtatgttgttgcttttgaggaatgcaattttattcgttcccaaagttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7715703 |
aaaggaaaaataaaaatatccctaacccctactaagacaaacattccagttgtatgttgttgcttttgaggaatgcaattttattcgttcccaaagttta |
7715802 |
T |
 |
| Q |
209 |
ttttagtaataattgtgttgtttgttttatactactccacatgacatttctaataaaaatatgttgaatacatttgcatgcatgcagtataaga |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7715803 |
ttttagtaataattgtgttgtttgttttatactactccacatgacatttctaataaaaatatgttgaatacatttgcatgcatgcagtataaga |
7715896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 142 - 209
Target Start/End: Complemental strand, 32961101 - 32961034
Alignment:
| Q |
142 |
aagacaaacattccagttgtatgttgttgcttttgaggaatgcaattttattcgttcccaaagtttat |
209 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
32961101 |
aagacagacattccagttgtatcttgttgcttttgaggaatataattttatgtgttcccgaagtttat |
32961034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University