View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_low_18 (Length: 308)
Name: NF20347_low_18
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 13 - 108
Target Start/End: Complemental strand, 8399755 - 8399660
Alignment:
| Q |
13 |
aagaatatcagttatagatgctgggttttgcattgaaggcacggtgatggaggatacagaagcctctagatgaatgtgatatgtagaagtcttgac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
8399755 |
aagaatatcagttatagatgctgggttttgcattgaaggcacggtgatggaggatacagaagcctttagaggaatgtgatatgtagaagtcttgac |
8399660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 246 - 291
Target Start/End: Complemental strand, 8398899 - 8398854
Alignment:
| Q |
246 |
taaaataattacttgatactctgctttatgccttaagccgcaattt |
291 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
8398899 |
taaaataattacttgatactttactttatgccttaagccgcaattt |
8398854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University