View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_low_20 (Length: 289)
Name: NF20347_low_20
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 13320316 - 13320038
Alignment:
| Q |
1 |
ttcataaaatcgattgaatgatagtgtcatttcttgctcaatctttcttcatcaaaatcttgacaatattttatattttttagatattgaagtctctcct |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||| |
|
|
| T |
13320316 |
ttcataaaatcgattgaatgatagtctcatttcttgctcagtctttcttcatcaaaatcttgacaatattttatatttttaagatattgaagcctttcct |
13320217 |
T |
|
| Q |
101 |
t---aaaaataatattttatgtcagcaaaaatacactcttgaatgttgatattttatccgactctagtatatttttactgtcaatcataaagttttttcc |
197 |
Q |
| |
|
| |||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13320216 |
tcttaaaaataatattttatgttaacaaaaatacactcttgaatgttgatattttatccgactctagtatatttttattgtcaatcataaagttttttcc |
13320117 |
T |
|
| Q |
198 |
atagaacaacaccttcgttaacaaccaaatgagagaaatccaaaaatcttctaccttatccaataatgtattatcgcct |
276 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13320116 |
atagaacaacaccttcgttgataaccaaatgagagaaatccaaaaatcttctaccttatccaacaatgtattatcgcct |
13320038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University