View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_low_22 (Length: 274)
Name: NF20347_low_22
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 257
Target Start/End: Original strand, 25952870 - 25953118
Alignment:
| Q |
11 |
ataaaatatcaatgatgggaagagctctc--accatttggatctggatgttgatgtttgaaattgatccatcatccatgcatatgagcattacaccaccg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25952870 |
ataaaatatcaatgatgggaagagctctctgaccatttggatctggatgttgatgtttgaaattgatccatcatccatgcatatgagcattacaccaccg |
25952969 |
T |
 |
| Q |
109 |
attattggacaaagtgaggaaaatcatataagagaaagttagtatagtccatgcatggtgaaggagaatgctatgattatgaatgttaatagataagtat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25952970 |
attattggacaaagtgaggaaaatcatataagagaaagttagtatagtccatggatggtgaaggagaatgctatgattatgaatgttaatagataagtat |
25953069 |
T |
 |
| Q |
209 |
taagcaaaatgtgtaggattagccatggatttcatttggaaaaactaga |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25953070 |
taagcaaaatgtgtaggattagccatggatttcatttggaaaaactaga |
25953118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University