View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20347_low_25 (Length: 261)

Name: NF20347_low_25
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20347_low_25
NF20347_low_25
[»] chr2 (2 HSPs)
chr2 (113-261)||(44830913-44831060)
chr2 (16-99)||(44830797-44830880)


Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 113 - 261
Target Start/End: Original strand, 44830913 - 44831060
Alignment:
113 gtgacatgttctattgttatcttttctcatcaacatgtactaaacgtttgaccgcatgttctatctttctcatcatttgcnnnnnnnnnncttttgcaat 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          ||||||||||    
44830913 gtgacatgttctattgttatcttttctcatcaacatgtactaaacgtttgaccgcatgttctatctttctcatcatttgc-tttttttttcttttgcaat 44831011  T
213 caaaagctttactacatttttgttgaattggttaaattattatgatgtt 261  Q
    ||||||||||||||||||||||||||||||| ||||||||| |||||||    
44831012 caaaagctttactacatttttgttgaattggctaaattattgtgatgtt 44831060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 44830797 - 44830880
Alignment:
16 atgcaacggtcaatgatgaaggtggtgttccgacgatggctgaaccgattgtacagccttcgtcatgtcttctttttgcttatg 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44830797 atgcaacggtcaatgatgaaggtggtgttccgacgatggctgaaccgattgtacagccttcgtcatgtcttctttttgcttatg 44830880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University