View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_low_25 (Length: 261)
Name: NF20347_low_25
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_low_25 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 113 - 261
Target Start/End: Original strand, 44830913 - 44831060
Alignment:
| Q |
113 |
gtgacatgttctattgttatcttttctcatcaacatgtactaaacgtttgaccgcatgttctatctttctcatcatttgcnnnnnnnnnncttttgcaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44830913 |
gtgacatgttctattgttatcttttctcatcaacatgtactaaacgtttgaccgcatgttctatctttctcatcatttgc-tttttttttcttttgcaat |
44831011 |
T |
 |
| Q |
213 |
caaaagctttactacatttttgttgaattggttaaattattatgatgtt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
44831012 |
caaaagctttactacatttttgttgaattggctaaattattgtgatgtt |
44831060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 44830797 - 44830880
Alignment:
| Q |
16 |
atgcaacggtcaatgatgaaggtggtgttccgacgatggctgaaccgattgtacagccttcgtcatgtcttctttttgcttatg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44830797 |
atgcaacggtcaatgatgaaggtggtgttccgacgatggctgaaccgattgtacagccttcgtcatgtcttctttttgcttatg |
44830880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University