View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_low_28 (Length: 248)
Name: NF20347_low_28
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 49 - 178
Target Start/End: Complemental strand, 228706 - 228577
Alignment:
| Q |
49 |
aatgtttctatttctatttacattcacgtagttctgtaacttagggagactctacaacaggaaccattagatttagtttccatcaactttataaagtgag |
148 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
228706 |
aatgtttctatttctatttacatttacgtagttctgtaacgtagggagactctacaacaggaaccattagatttagtttccatcaactttataaagtgag |
228607 |
T |
 |
| Q |
149 |
atccttctcatgttttcatacacttactcc |
178 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |
|
|
| T |
228606 |
atccttgtcatgttttcatacacttcctcc |
228577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University