View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_low_31 (Length: 239)
Name: NF20347_low_31
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 21496312 - 21496516
Alignment:
| Q |
20 |
attgattttatgaaatataaggcgtcaaattttgatctaacagtttcggttgattgtgtaaatgcatgaaattccgataactgaatcaaattttcaaatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21496312 |
attgattttatgaaatataaggcgtcaaatttcgatctaacagttctggttgattgcgtaaatgcatgaaattccgataactgaatcaaattttcaaatc |
21496411 |
T |
 |
| Q |
120 |
ttttaatgtatgtttgacatgaccctggacatgtcagaatcatcgtaactctgacgcagccaacgttatgccaaacatattgcagacactaattgtcatt |
219 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21496412 |
ttttaatgtatgtttgacatgactctggacatgccagaatcatcataactctgacgcagccaacgttatgccaaacatattgcagacactaattgtcatt |
21496511 |
T |
 |
| Q |
220 |
atttt |
224 |
Q |
| |
|
||||| |
|
|
| T |
21496512 |
atttt |
21496516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University