View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_low_34 (Length: 236)
Name: NF20347_low_34
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 32 - 196
Target Start/End: Complemental strand, 21137074 - 21136910
Alignment:
| Q |
32 |
tttgattcaaccggttgaattgaaccaatagatccatgatccgaagatcacactggtataatctccgttttaattaagagcataaaatagtaaattagtt |
131 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21137074 |
tttggttcaaccggttgaattgaaccaatagatccatgatccgaagatcacactggtttaatctccgttttgattaagagcataaaatagtaaattagtt |
21136975 |
T |
 |
| Q |
132 |
ttaaaatcttcccctctcatctccccatctcttttaaaccatatttatagataattatgtataga |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21136974 |
ttaaaatcttcccctctcatctccccatctcttttaaacgatatttatagataattatgtataga |
21136910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 21137094 - 21137064
Alignment:
| Q |
1 |
atatatttatatattaattatttggttcaac |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21137094 |
atatatttatatattaattatttggttcaac |
21137064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University