View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20347_low_7 (Length: 493)
Name: NF20347_low_7
Description: NF20347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20347_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 9e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 9e-68
Query Start/End: Original strand, 323 - 477
Target Start/End: Original strand, 9911654 - 9911808
Alignment:
| Q |
323 |
ttttatttcatctggtctagtatcaaatcagaatattttgtcattttagaaagctcttttttagcttttgggaaatggcataaatatgaatttttggaaa |
422 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9911654 |
ttttattccatctggtctagtatcaaatcagaatattttgttattttagaaagctcttttatagcttttgggaaatggcataaatatgaatttttggaaa |
9911753 |
T |
|
| Q |
423 |
gatatttggcgcggtccttccttatttctctatctcaacgttcctatgaatcaac |
477 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9911754 |
gatatttggtgtggtccttccttatttctctatctcaacattcctatgaatcaac |
9911808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University