View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20348_high_19 (Length: 233)
Name: NF20348_high_19
Description: NF20348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20348_high_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 21 - 220
Target Start/End: Original strand, 18151158 - 18151366
Alignment:
| Q |
21 |
atgtttatgtatattaccctttttccggtgttgcgtcacataacggaaattttgatacatctcttccctctatctggtggttataatgctttcagctcgc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18151158 |
atgtttatgtatattaccctttttccggtgttgcgtcacataacggaaattttaatacatctcttccctctatctggtggttataatgctttcagctcgc |
18151257 |
T |
|
| Q |
121 |
acttttggggcacctaggatagtcgttgtggatattgttaaattttcaacaaacattc---------tggtatattgattgaatcagaagttttttaaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18151258 |
acttttggggcacctaggatagtcgttgtggatattgttaaattttcaacaaacattcaggtatattaggtatattgattgaatcagaagttttttaaat |
18151357 |
T |
|
| Q |
212 |
cttctatat |
220 |
Q |
| |
|
||| ||||| |
|
|
| T |
18151358 |
cttttatat |
18151366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 153
Target Start/End: Original strand, 22993096 - 22993149
Alignment:
| Q |
100 |
gttataatgctttcagctcgcacttttggggcacctaggatagtcgttgtggat |
153 |
Q |
| |
|
|||| ||||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
22993096 |
gttacaatgctttcggctcgtgcttttggagcacctaggatagtcgttgtggat |
22993149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 100 - 153
Target Start/End: Complemental strand, 23795302 - 23795249
Alignment:
| Q |
100 |
gttataatgctttcagctcgcacttttggggcacctaggatagtcgttgtggat |
153 |
Q |
| |
|
|||| ||||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
23795302 |
gttacaatgctttcggctcgtgcttttggagcacctaggatagtcgttgtggat |
23795249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 189
Target Start/End: Original strand, 22993195 - 22993233
Alignment:
| Q |
151 |
gatattgttaaattttcaacaaacattctggtatattga |
189 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
22993195 |
gatattgttaaagtttcaacaaacattcaggtatattga |
22993233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 189
Target Start/End: Complemental strand, 23795203 - 23795165
Alignment:
| Q |
151 |
gatattgttaaattttcaacaaacattctggtatattga |
189 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
23795203 |
gatattgttaaagtttcaacaaacattcaggtatattga |
23795165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University