View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20348_low_16 (Length: 314)
Name: NF20348_low_16
Description: NF20348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20348_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 19 - 297
Target Start/End: Complemental strand, 26361717 - 26361439
Alignment:
| Q |
19 |
actcagacatactggtacaggacacagtccctgagtgtcaagcctggttgaatgaccgagaggccaagctgtttggtatcgagcacagcccctgagtctc |
118 |
Q |
| |
|
|||||| ||||||| ||||| ||||| |||||||||||||||||||||||||| ||| | |||||| |||||||||||||||||||| | |||||||| |
|
|
| T |
26361717 |
actcagtcatactgatacagaacacaacccctgagtgtcaagcctggttgaatgcccgggtggccaaactgtttggtatcgagcacaggcgttgagtctc |
26361618 |
T |
 |
| Q |
119 |
aaacctgaagagcaaggacgttctgaatgatcgagtggtcaaacagtttggtaccaaacatagtcccaagtgtcaagcttgaaagggcgaaaacgttctg |
218 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
26361617 |
aaacctgaagagaaaggaaattctgaatgatcgagtagtcaaacagtttggtaccaaacacagtcccaagtgtcaagcttgaaagggcgaagatgttctg |
26361518 |
T |
 |
| Q |
219 |
aatgaccaagtgaccaaacagtttggtcccaaacactatctatcttggtgagtttaatgcataactcggattacttgat |
297 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26361517 |
aatgtccaagtggtcaaacagtttgatcccaaacactatctatcgtggtgagtttaatgcataactcggattacttgat |
26361439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University