View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20348_low_2 (Length: 637)
Name: NF20348_low_2
Description: NF20348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20348_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 8e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 504 - 601
Target Start/End: Original strand, 6808012 - 6808110
Alignment:
| Q |
504 |
aacttaatgcaatcaccttataattaagtccagtttgatggcttgc-caagaaaaaattccagtctgatgggatagattgtgaccatctacctcacaat |
601 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
6808012 |
aacttaattcaatcaccttacaattaagtccagtttgatggcttgctcaagcaaaaattccagtcagatgggatagattgtgaccatctacctcccaat |
6808110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 504 - 601
Target Start/End: Original strand, 6818208 - 6818306
Alignment:
| Q |
504 |
aacttaatgcaatcaccttataattaagtccagtttgatggcttgc-caagaaaaaattccagtctgatgggatagattgtgaccatctacctcacaat |
601 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
6818208 |
aacttaattcaatcaccttacaattaagtccagtttgatggcttgctcaagcaaaaattccagtcagatgggatagattgtgaccatctacctcccaat |
6818306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University