View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20348_low_21 (Length: 247)

Name: NF20348_low_21
Description: NF20348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20348_low_21
NF20348_low_21
[»] chr3 (1 HSPs)
chr3 (17-232)||(2458724-2458939)


Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 232
Target Start/End: Complemental strand, 2458939 - 2458724
Alignment:
17 aatataactgaaggtttattatagccagcaatacagaggataccgttgcaagagccaacgatataataatcttcaacataataattgaaaggacctgtat 116  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2458939 aatataactgaaggtttattatagccagcaatacagatgataccgttgcaagagccaacgatataataatcttcaacataataattgaaaggacctgtat 2458840  T
117 attgtgtgaccatagtggttacgttggtggaaacgtaatcaaggggataacaagttaaaacacacttacttaaggtataagagtagctaactttgtatag 216  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
2458839 attgtgtgaccatagtggttacgttggtggaaacataatcaaggggatgacaagttaaaacacacttacttaaggtataagagtagctaactttgtatag 2458740  T
217 gtggtgcgtggtggat 232  Q
    ||||||||||||||||    
2458739 gtggtgcgtggtggat 2458724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University