View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20349_high_1 (Length: 476)
Name: NF20349_high_1
Description: NF20349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20349_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 437; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 437; E-Value: 0
Query Start/End: Original strand, 20 - 464
Target Start/End: Original strand, 42005764 - 42006208
Alignment:
| Q |
20 |
cttacctgacggtcaagtcatcatgttatataccggttcaaccaatgaaacagtgcaagtccaaaatcttgcataccctgctgatctcaatgaccctctc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42005764 |
cttacctgacggtcaagtcatcatgttatatactggttcaaccaatgaaacagtgcaagtccaaaatcttgcataccctgctgatctcaatgaccctctc |
42005863 |
T |
 |
| Q |
120 |
cttgtggattggatcaaataccctgccaacccggttctcgtccctccaccaggcattcttccaaaggactttcgcgacccaacaactgcttggctaactt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42005864 |
cttgtggattggatcaaataccctgccaacccggttctcgtccctccaccaggcattcttccaaaggactttcgcgacccaacaactgcttggctcactt |
42005963 |
T |
 |
| Q |
220 |
ctgaaggaaaatggagaatcaccataggctccaagattaacaaaactggcgttgctttggtttacgacacagtggacttcaagacctatgagcgtaaaga |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42005964 |
ctgaaggaaaatggagaatcaccataggctccaagattaacaaaactggcgttgctttggtttacgacacagtggacttcaagacctatgagcgtaaaga |
42006063 |
T |
 |
| Q |
320 |
ggatttgcttgacgctgttcctggcaccggtatgtgggagtgtgtggactttttccctgtttccatgaagtctgaaaatggcttggatacttctgttaat |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006064 |
ggatttgcttgacgctgttcctggcaccggtatgtgggagtgtgtggactttttccctgtttccatgaagtctgaaaatggcttggatacttctgttaat |
42006163 |
T |
 |
| Q |
420 |
ggggaggaggttaagcatgtgatgaaggtgagcttggatgatgat |
464 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42006164 |
ggggaggaggttaagcatgtgatgaaggtgagcttggatgatgat |
42006208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University