View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20349_low_13 (Length: 294)
Name: NF20349_low_13
Description: NF20349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20349_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 133 - 235
Target Start/End: Original strand, 33373254 - 33373356
Alignment:
| Q |
133 |
tatgtttaaaaatgtaatttttggataaatattttattattctttagagtttgaaaatcgtcggggtaacttaatatttttcaagacttatctatcatga |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33373254 |
tatgtttaaaaatgtaatttttggataaatattttattattctttagagtttgaaaatcgtaggggtaacttaatatttttcaagacttatctatcatga |
33373353 |
T |
 |
| Q |
233 |
ggt |
235 |
Q |
| |
|
||| |
|
|
| T |
33373354 |
ggt |
33373356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 49 - 141
Target Start/End: Original strand, 33371825 - 33371917
Alignment:
| Q |
49 |
catttttcagtttctttgtgcttctactctatgttaattaaactttttagaacaaatttaataataattacgagaccgcttgcttatgtttaa |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33371825 |
catttttcagtttctttgtgcttctactctatgttaattaaactttttagaacaaatttaataataattacgagaccgcttgcttatgtttaa |
33371917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 33371706 - 33371755
Alignment:
| Q |
1 |
attagaggaagatgttgcatatcactgatgctatattgcagaggttacca |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33371706 |
attagaggaagatgttgcatatcactgatgctatattgcagaggttacca |
33371755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University