View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2034R-Insertion-12 (Length: 81)
Name: NF2034R-Insertion-12
Description: NF2034R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2034R-Insertion-12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 9 - 74
Target Start/End: Complemental strand, 21470755 - 21470690
Alignment:
| Q |
9 |
tatgtttcaaaatatttgctaagcaaacaaatacaagatgaattgcgaaacgttatcttacttgtt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| || |||||||||| |||| |
|
|
| T |
21470755 |
tatgtttcaaaatatttgctaagcaaacaaatacaaaatgaattgtttaatgttatcttacctgtt |
21470690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University