View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2034R-Insertion-6 (Length: 293)
Name: NF2034R-Insertion-6
Description: NF2034R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2034R-Insertion-6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 9 - 268
Target Start/End: Original strand, 33421432 - 33421691
Alignment:
| Q |
9 |
gattcatcatcccaatgtcccaaaccatcttccaatcactccatttcggcgggattcaccgggccggttactgcaactactcgccgctagtaccggggtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33421432 |
gattcatcatcccaatgtcccaaaccatcttccaatcactccatttcggcgggattcaccgggccggttactgcaactactcgccgctagtaccggggtc |
33421531 |
T |
|
| Q |
109 |
caacacctccttcagtgaccgtcctcctgctgagatggctccgcttttccctggttgtgattacaatcgctggcttattattattgataagcctggtggt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33421532 |
caacacctccttcagtgaccgtcctcctgctgagatggctccgcttttccctggttgtgattacaatcactggcttattattattgataagcctggtggt |
33421631 |
T |
|
| Q |
209 |
gaaggcgctaccaaacagcagatgattgattgttacgtcaaaacccttgcacaggttctg |
268 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33421632 |
gaaggtgctaccaaacagcagatgattgattgttacgtcaaaacccttgcacaagttctg |
33421691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 118 - 240
Target Start/End: Complemental strand, 15695423 - 15695301
Alignment:
| Q |
118 |
cttcagtgaccgtcctcctgctgagatggctccgcttttccctggttgtgattacaatcgctggcttattattattgataagcctggtggtgaaggcgct |
217 |
Q |
| |
|
|||||| || ||||| ||| | || ||||||||||| || || || |||||||| | | ||||||||| |||| ||||| |||||||||||||| ||| |
|
|
| T |
15695423 |
cttcagcgagcgtccgcctacggatatggctccgctgtttccagggtgtgattatgaacattggcttattgttatggataaacctggtggtgaaggtgct |
15695324 |
T |
|
| Q |
218 |
accaaacagcagatgattgattg |
240 |
Q |
| |
|
| |||||||| ||||||||||| |
|
|
| T |
15695323 |
tcgaaacagcaaatgattgattg |
15695301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University