View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2034R-Insertion-7 (Length: 233)
Name: NF2034R-Insertion-7
Description: NF2034R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2034R-Insertion-7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 8 - 122
Target Start/End: Original strand, 8626365 - 8626479
Alignment:
| Q |
8 |
actagtacgatgtcttaattgtgaatgtgcaatctttgtttgacagacataagctaccttggctttgcagcgagagttgtcacgcctgagttagttcacg |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8626365 |
actagtacgatttcttaattgtgaatgtgcaatctttgtttgacaaacataagctaccttggctttgcagcgagagttgtcacgcctgagttagttcacg |
8626464 |
T |
 |
| Q |
108 |
gtgaatctagttctt |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8626465 |
gtgaatctagttctt |
8626479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University