View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2034R-Insertion-8 (Length: 168)
Name: NF2034R-Insertion-8
Description: NF2034R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2034R-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-68
Query Start/End: Original strand, 9 - 155
Target Start/End: Original strand, 46721655 - 46721801
Alignment:
| Q |
9 |
attgcttcattgtatttgtatattcatatacatatataaatatmatgctttttggtttttcctgtttctatacargstctccctcarcagcwwattgtwa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||||| |||| ||||| | |
|
|
| T |
46721655 |
attgcttcattgtatttgtatattcatatacatatataaatataatgctttttggtttttcctgtttctatacaggctctccctcagcagcaaattgtta |
46721754 |
T |
|
| Q |
109 |
actatcccacttacaagcttgkccttgtaggtgatggaggaaccggt |
155 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
46721755 |
actatcccactttcaagcttgtccttgtaggtgatggaggaaccggt |
46721801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University