View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2034_high_6 (Length: 248)
Name: NF2034_high_6
Description: NF2034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2034_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 20478577 - 20478796
Alignment:
| Q |
1 |
caattcccttaataatattgtgatagttttatataatctacactgtaatgcaaacagttggttgcagtgttgttaaatggtggcgccatggcgagaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
20478577 |
caattcccttaataatattgtgatagttttatataatctacactgtaatgcaaacagttggttgcagtgttgttaaatggtggcaccatggcgggaatgc |
20478676 |
T |
 |
| Q |
101 |
ggttatttaacaaccgcaactgccatagacagttggtgaagaaatgccgatgcctgccatggtggcaccataggccgcaattagacagttggactgggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20478677 |
ggttatttaacaaccgcaactgccataaacagt-----------tgccgatgcctgccatggtggcaccataggccgcaattagacagttggactgggag |
20478765 |
T |
 |
| Q |
201 |
tcgggaagaatgcaattaggcagtcaacctg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20478766 |
tcgggaagaatgcaattaggcagtcaacctg |
20478796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University