View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2034_low_18 (Length: 231)
Name: NF2034_low_18
Description: NF2034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2034_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 21 - 223
Target Start/End: Complemental strand, 18252068 - 18251866
Alignment:
| Q |
21 |
ttgtatactatatagtttgtagctagtgtttaccctccccttctcactaggaaatgacaccggtgatttggagtttggtcggaaagcaaattcagtttct |
120 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
18252068 |
ttgtatgctatatagtttgtagctagtgtttaccctctccttctcactagaaaatgacaccggtgatttggagtttggtcagaaagcaaactcagtttct |
18251969 |
T |
|
| Q |
121 |
cttgaacaatttctcctcgatgctcattaaccatttgtatctaattgcttggttattttatatatccatgtcttttctctaccactcttgttatttcttc |
220 |
Q |
| |
|
||||||||||||||||||||| || |||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18251968 |
cttgaacaatttctcctcgatacttattaaccacttgtatctaattgtttggttattttatatatccacgtcttttctctaccactcttgttatttcttc |
18251869 |
T |
|
| Q |
221 |
tca |
223 |
Q |
| |
|
||| |
|
|
| T |
18251868 |
tca |
18251866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University