View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2034_low_20 (Length: 208)
Name: NF2034_low_20
Description: NF2034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2034_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 40104468 - 40104291
Alignment:
| Q |
18 |
tcaacatatataatgatattatacattgattcaatgcatctttggaagcggcgaatcaagttcaattctgatggtgtacataaaaatttagttaaacttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
40104468 |
tcaacatatataatgatattatacattgattcaaggcatctttggaagcggcgaatcaagttcaattctgatggtgtacatacaaatttagttaaaattt |
40104369 |
T |
|
| Q |
118 |
tcacgttatgggagtctcctccgaaataataatggtacttgtttgagagatatgcataaaggatttgttcttgtgatg |
195 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||| |
|
|
| T |
40104368 |
tcacgtaatgggagtctcctccgaaataataatggtacttgtttgagagatatgcatgaaggattggttcttgcgatg |
40104291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University