View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2034_low_9 (Length: 281)
Name: NF2034_low_9
Description: NF2034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2034_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 21 - 262
Target Start/End: Original strand, 34811325 - 34811566
Alignment:
| Q |
21 |
tgtatgtggattttattttaccatgtttgtactttatcagagatattttagagtgaaatgctaggtgcagcacatatgattaaatgagatctatttgaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34811325 |
tgtatgtggattttattttaccatgtttgtactttatcagagatattttagagtgaaatgctaggtgcagcacatatgattaaatgagatctatttgaat |
34811424 |
T |
|
| Q |
121 |
ttcaatcaataaaatgtaatattttcgacaatgtgttgctagcaattgcataccttttgtttaaggttcgttaacgactccatcatcaattgcatctgca |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34811425 |
ttcaatcaataaaatgtaatgttttcgacaatgtgttgctagcaattgcataccttttgtttaaggttcgttaacgactccatcatcaattgcatctgca |
34811524 |
T |
|
| Q |
221 |
taaaactttcatgaattaaaaaggtgggcatatcgatgcact |
262 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34811525 |
taaaactttcatgaattaaaaaggtggacatatcgatgcact |
34811566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University