View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20350_low_7 (Length: 247)
Name: NF20350_low_7
Description: NF20350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20350_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 37771675 - 37771898
Alignment:
| Q |
17 |
gaattttgcatctttcatcttgtgaccgagtgcaaactttttggttacaaatacatgtaccacatccaaaagttatagagaatatttccaagtactcttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37771675 |
gaattttgcatctttcatcttgtgaccgagtacaaactttttggttacaaatacatgtaccacatccaaaagttatagagaatatttccaagtactcttg |
37771774 |
T |
|
| Q |
117 |
ggtaaaaaacacttttcaaagatagtgtagaaaaattgtgtatgacgaggcagtttgtttattaacatatctttttcattatttgttagtgattcgtcga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37771775 |
ggtaaaaaacacttttcaaagatagtgtagaaaaattgtgtatgacgaggcagtttgtttattaacatatctttttcattatttgttagtgattcgtcga |
37771874 |
T |
|
| Q |
217 |
acataaatgcttaaagaataatct |
240 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
37771875 |
acataaatacttaaagaataatct |
37771898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University