View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20350_low_9 (Length: 201)
Name: NF20350_low_9
Description: NF20350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20350_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 26 - 187
Target Start/End: Complemental strand, 43770135 - 43769972
Alignment:
| Q |
26 |
atgttttactgcatatctttgtttctctttttctgattgagcctaaatatagtctg--agaaatcatccacataaggaactaagaaataatgtcataatt |
123 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43770135 |
atgttttaccgcatatctttgtttctctttttctggttgagcctaaatatagtctgtgagaaatcatccacataaggaactaagaaataatgtcataatt |
43770036 |
T |
 |
| Q |
124 |
aataattatatacatgaggtgattccaaaccttcctttttatggaataagcactggctattttt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43770035 |
aataattatatacatgaggtgattccaaaccttcctttttatggaataagcactggctattttt |
43769972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 188
Target Start/End: Complemental strand, 43780819 - 43780760
Alignment:
| Q |
130 |
tatatacatgaggtgattccaaaccttccttt-ttatggaataagcactggctatttttg |
188 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| ||||||||||||| || |||||||||| |
|
|
| T |
43780819 |
tatatacaagaggtgattccaaaccctcctttcttatggaataagccctagctatttttg |
43780760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University