View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20351_high_12 (Length: 240)
Name: NF20351_high_12
Description: NF20351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20351_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 21 - 215
Target Start/End: Original strand, 48966151 - 48966345
Alignment:
| Q |
21 |
cagtcaggtggatctttctccatgaaatactgaattggttcttggaggagcattgctccagcgtatagtttgccggaggaggcaagatcaggggtgttgg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48966151 |
cagtcaggtggatctttctccatgaaattctgaattggttcttggaggagcattgctcctgcgtatagtttgccggaggaggcaagatcaggggtgttgg |
48966250 |
T |
 |
| Q |
121 |
acatggattcgacaccggaggggagaccaacttgttggtagggaaaatcaacggtgtgaatgcggaggaagaaaggatctatggagggaagagat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48966251 |
acatggattcgacaccggaggggagaccaacttgttggtaggggaaatcaacggtgtgaatgcggaggaagagaggatctatggagggaagagat |
48966345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 48963104 - 48963159
Alignment:
| Q |
21 |
cagtcaggtggatctttctccatgaaatactgaattggttcttggaggagcattgc |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||| | |||||||||||||| |
|
|
| T |
48963104 |
cagtcaggtggatccttctccatgaaatcctgaattggtccgtggaggagcattgc |
48963159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 48958963 - 48959018
Alignment:
| Q |
21 |
cagtcaggtggatctttctccatgaaatactgaattggttcttggaggagcattgc |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
48958963 |
cagtcaggtggatccttctccatgaaatcgtgaataggttcacggaggagcattgc |
48959018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University