View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20351_high_9 (Length: 251)
Name: NF20351_high_9
Description: NF20351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20351_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 8 - 244
Target Start/End: Complemental strand, 55339450 - 55339212
Alignment:
| Q |
8 |
ttctttcttgggccctatttggcccaatctggctcctaattttctttcaaaaattcaaaaatcataaggttaacctagtccctaacacgnnnnnnnnnnn |
107 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
55339450 |
ttctttcttgggccctattttgcccactctggctcctaattttctttcaaaaaaacaaaaatcataaggttaagctagtccctaacacgttttttttttt |
55339351 |
T |
 |
| Q |
108 |
--aatttaaaattatctactaaaatggctcaaaccagtccttagctaattttgctcaaacaagtgttgcatcaataaaatgacacattaatccctctatt |
205 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
55339350 |
ttaatttaatattatctactaaaatggctcagaccagtcgttagctaattttgctcaaataagcgttgcatcaataaaatgacacattaatccctctatt |
55339251 |
T |
 |
| Q |
206 |
ttgatttctcaataaaatgtctcatattggtctctgctc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55339250 |
ttgatttctcaataaaatgtctcatattggtctttgctc |
55339212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University