View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20351_low_12 (Length: 240)

Name: NF20351_low_12
Description: NF20351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20351_low_12
NF20351_low_12
[»] chr4 (3 HSPs)
chr4 (21-215)||(48966151-48966345)
chr4 (21-76)||(48963104-48963159)
chr4 (21-76)||(48958963-48959018)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 21 - 215
Target Start/End: Original strand, 48966151 - 48966345
Alignment:
21 cagtcaggtggatctttctccatgaaatactgaattggttcttggaggagcattgctccagcgtatagtttgccggaggaggcaagatcaggggtgttgg 120  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
48966151 cagtcaggtggatctttctccatgaaattctgaattggttcttggaggagcattgctcctgcgtatagtttgccggaggaggcaagatcaggggtgttgg 48966250  T
121 acatggattcgacaccggaggggagaccaacttgttggtagggaaaatcaacggtgtgaatgcggaggaagaaaggatctatggagggaagagat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
48966251 acatggattcgacaccggaggggagaccaacttgttggtaggggaaatcaacggtgtgaatgcggaggaagagaggatctatggagggaagagat 48966345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 48963104 - 48963159
Alignment:
21 cagtcaggtggatctttctccatgaaatactgaattggttcttggaggagcattgc 76  Q
    |||||||||||||| ||||||||||||| |||||||||| | ||||||||||||||    
48963104 cagtcaggtggatccttctccatgaaatcctgaattggtccgtggaggagcattgc 48963159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 48958963 - 48959018
Alignment:
21 cagtcaggtggatctttctccatgaaatactgaattggttcttggaggagcattgc 76  Q
    |||||||||||||| |||||||||||||  ||||| |||||  |||||||||||||    
48958963 cagtcaggtggatccttctccatgaaatcgtgaataggttcacggaggagcattgc 48959018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University