View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20351_low_13 (Length: 238)
Name: NF20351_low_13
Description: NF20351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20351_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 41 - 227
Target Start/End: Complemental strand, 4288722 - 4288539
Alignment:
| Q |
41 |
tcattgatttcccatgcttttttattctcgaacttatcaatttatgtttgtatgtatttttgcatagttaagagtagtctctcttgttatgttcttgtca |
140 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||| ||||||| |||||||||||||||||| || |||||| |||||||||||||||| |||||||| |
|
|
| T |
4288722 |
tcattgatttcccattcttttttattctcggacttataaatttatatttgtatgtatttttgcaaaggtaagagcagtctctcttgttatgctcttgtca |
4288623 |
T |
|
| Q |
141 |
aggtgtcttctgatttcttagtttgagtttcatcctcttgaataaccattggaatgtaatcaacgtatgattactctccacattctt |
227 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4288622 |
aggt---ttctgatttctcagtttgagtttcatcctcttgagtaaccattcgaatgtaatcaacgtatgattactctccacattctt |
4288539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 41 - 151
Target Start/End: Complemental strand, 4299565 - 4299455
Alignment:
| Q |
41 |
tcattgatttcccatgcttttttattctcgaacttatcaatttatgtttgtatgtatttttgcatagttaagagtagtctctcttgttatgttcttgtca |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| | |||| |||| |||||||||| ||||||| | ||||||||||| || ||||||| |
|
|
| T |
4299565 |
tcattgatttcccatgcttttttattctcagacttatcaatttttatttgaatgtgtttttgcatacttaagagcattctctcttgttctgctcttgtcc |
4299466 |
T |
|
| Q |
141 |
aggtgtcttct |
151 |
Q |
| |
|
| ||||||||| |
|
|
| T |
4299465 |
aagtgtcttct |
4299455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University