View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20351_low_14 (Length: 236)
Name: NF20351_low_14
Description: NF20351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20351_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 16 - 129
Target Start/End: Complemental strand, 55339641 - 55339513
Alignment:
| Q |
16 |
caaacaactactgataatactaataatcagaaaaaagatgatgggaatgtgggggg----------------taacgaacaaaggttgaagaagaatatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55339641 |
caaacaactactgataatactaataatcagaaaaaagatgatgggactgtgggggggggggggggggggggttaacgaacaaaggttgaagaagaatatt |
55339542 |
T |
 |
| Q |
100 |
ccattcattgtgtgagaaaaataatctaag |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55339541 |
-cattcattgtgtgagaaaaataatctaag |
55339513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 155 - 223
Target Start/End: Complemental strand, 55339515 - 55339442
Alignment:
| Q |
155 |
aagttggtgagtgcagtattggaaaaggaggtgtggtg-----tggatagaaatgaacaaccctcttctttctt |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55339515 |
aagttagtgagtgcagtattggaaaaggaggtgtggtgtggtatggatagaaatgaacaaccctcttctttctt |
55339442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University