View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20351_low_16 (Length: 215)

Name: NF20351_low_16
Description: NF20351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20351_low_16
NF20351_low_16
[»] chr4 (2 HSPs)
chr4 (73-200)||(40853208-40853335)
chr4 (14-73)||(40853385-40853444)
[»] chr1 (1 HSPs)
chr1 (106-170)||(11583766-11583830)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 1e-61; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 73 - 200
Target Start/End: Complemental strand, 40853335 - 40853208
Alignment:
73 aacaacggtgaaaacgatgacagtaatgcacctgatccacggggaagaaaatcacgtccaacgatactctctaacaccgacgattttccagaactctgca 172  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40853335 aacaatggtgaaaacgatgacagtaatgcacctgatccacggggaagaaaatcacgtccaacgatactctctaacaccgacgattttccagaactctgca 40853236  T
173 tatttttcaaaaataagaaccaaaaaat 200  Q
    ||||||| ||||||||||||||||||||    
40853235 tatttttaaaaaataagaaccaaaaaat 40853208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 14 - 73
Target Start/End: Complemental strand, 40853444 - 40853385
Alignment:
14 cacagacacgctaacacctatgattacttgagaaattaatatttatctgttagtcttcga 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||    
40853444 cacagacacgctaacacctatgattacttgagaaattaatatttatatgttcgtcttcga 40853385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 170
Target Start/End: Complemental strand, 11583830 - 11583766
Alignment:
106 gatccacggggaagaaaatcacgtccaacgatactctctaacaccgacgattttccagaactctg 170  Q
    |||||||| || |||||||| | |||||| | |||||||||||| |||||||| || ||||||||    
11583830 gatccacgtggtagaaaatcccttccaacaacactctctaacactgacgatttccctgaactctg 11583766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University