View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20351_low_5 (Length: 340)
Name: NF20351_low_5
Description: NF20351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20351_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 25 - 246
Target Start/End: Original strand, 4474478 - 4474699
Alignment:
| Q |
25 |
atctttgttaaggaaaatatgataacaaaagaacaataaaatcagggtgaaggtcttgtcatagttaaccttggtgactcaagagcaatattaggaacaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474478 |
atctttgttaaggaaaatatgataacaaaagaacaataaaatcagggtgaaggtcttgtcatagttaaccttggtgactcaagagcaatattaggaacaa |
4474577 |
T |
|
| Q |
125 |
tccaagatgaaaaactcaaagccattcaattgaccactgatttgaagcctggtttgccttgtaagattcttctcataaactaactaccatgcagcttctt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4474578 |
tccaagatgaaaaactcaaagccattcaattaaccactgatttgaagcctggtttgccttgtaagattcctctcataaactaactaccatgcagcttctt |
4474677 |
T |
|
| Q |
225 |
ttcaagtattggtttgacggaa |
246 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4474678 |
ttcaagtattggtttgacggaa |
4474699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University