View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20351_low_8 (Length: 278)
Name: NF20351_low_8
Description: NF20351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20351_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 88 - 200
Target Start/End: Complemental strand, 28920237 - 28920125
Alignment:
| Q |
88 |
gttattaagtgatatttggaagcatagagtaaaggaatacttgaagattatagtagtgtaaactttaattgtttgttaaaagatgataaacaccgggaga |
187 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28920237 |
gttattaagtgatatttggaagcatagggtaaaggaatacttgaagattatagtagtgtaaactttaattgtttgttaaaagatgataaacaccgggaga |
28920138 |
T |
|
| Q |
188 |
gtgtgaatatttt |
200 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28920137 |
gtgtgaatatttt |
28920125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 28920567 - 28920473
Alignment:
| Q |
1 |
gtattttattgatgagtaaagtgtgaattcgtagaaaattttatgcgaacataagaagctgagtttttagtagtgagatgtaagaatgttattaa |
95 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28920567 |
gtattttattgttgtgtaaagtgtgaattcgtagaaaattttatgtgaacataagaagctgagtttttagtagtgagatgtaagaatgttattaa |
28920473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University