View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20352_high_6 (Length: 295)
Name: NF20352_high_6
Description: NF20352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20352_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 29448331 - 29448612
Alignment:
| Q |
1 |
gcaatgattcttcttcatggtcaccaagatcatataaagcattcgcattattatgctgctgttcgtgatgattactttctatttttggcgaaataccgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29448331 |
gcaatgattcttcttcatggtcaccaagatcatataaagcattcacattattatgctgctgttcgtgatgattactttctatttttggcgaaataccgtc |
29448430 |
T |
 |
| Q |
101 |
actagattgattttgttccttcgctaaattctgttgcatcataataccacctaaactgctcagtgttttacttttcgttccatcggtatcagagatgcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| | |
|
|
| T |
29448431 |
actagattgattttgttccttcgctaaattctgttgcatcataataccacctaaactgctcagtgttttacttttcgttccttcggtgtcagagatgcga |
29448530 |
T |
 |
| Q |
201 |
aaacttaacagctttgcaggttctaattccagtggaggctgttcatccttctgtacagccatttcagtaagagtttgatatt |
282 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29448531 |
aaatttaacagctttgcaggttctaattccagtggaggctgttcatccttctgtacagccatttcagtaagagtttgatatt |
29448612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University