View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20352_high_8 (Length: 216)
Name: NF20352_high_8
Description: NF20352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20352_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 79 - 199
Target Start/End: Complemental strand, 40948487 - 40948367
Alignment:
| Q |
79 |
atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagtat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40948487 |
atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagtac |
40948388 |
T |
 |
| Q |
179 |
taaacattgatacacaatatt |
199 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40948387 |
taaacattgatacacaatatt |
40948367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 40945556 - 40945494
Alignment:
| Q |
1 |
ctgagctgaaacatattgtttttgggatagctgcttcatcggatttatggaatacaagaaaag |
63 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40945556 |
ctgagctgaaacacattgtttttgggatagctgcttcatcaaatttatggaatacaagaaaag |
40945494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University