View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20352_low_11 (Length: 216)

Name: NF20352_low_11
Description: NF20352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20352_low_11
NF20352_low_11
[»] chr2 (2 HSPs)
chr2 (79-199)||(40948367-40948487)
chr2 (1-63)||(40945494-40945556)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 79 - 199
Target Start/End: Complemental strand, 40948487 - 40948367
Alignment:
79 atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagtat 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
40948487 atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagtac 40948388  T
179 taaacattgatacacaatatt 199  Q
    |||||||||||||||||||||    
40948387 taaacattgatacacaatatt 40948367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 40945556 - 40945494
Alignment:
1 ctgagctgaaacatattgtttttgggatagctgcttcatcggatttatggaatacaagaaaag 63  Q
    ||||||||||||| ||||||||||||||||||||||||||  |||||||||||||||||||||    
40945556 ctgagctgaaacacattgtttttgggatagctgcttcatcaaatttatggaatacaagaaaag 40945494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University