View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20353_high_4 (Length: 331)
Name: NF20353_high_4
Description: NF20353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20353_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 6138064 - 6138376
Alignment:
| Q |
1 |
aaattggctaagagaggagagcagcccggtttgcgaagcaaggcaattaagatatatgaggctaatcaattcttcagataatcatgcttcatcttcatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6138064 |
aaattggctaagagaggagagcagcccggttcgcgaagcaaggcaattaagatatatgaggctaatcaattcttcagataatcatgcttcatcttcatcc |
6138163 |
T |
 |
| Q |
101 |
tcttctcctccaagattatttggttcgtctcttggcatggttcctactagttacaatgctttggggggtagtagcagcagcaacaacaataaccctagca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6138164 |
tcttctcctccaagattatttggttcgtctcttggcatggttcctactagttacaatgctttggggggtagtagcagcaacaacaacaataaccctagca |
6138263 |
T |
 |
| Q |
201 |
ctaattcccacttcatcaatggaggactggcacgcgcatcgttcatcccggctagagaaactggagctggacctgctgtaggatatgactaccaaagaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6138264 |
ctaattcccacttcatcaatggaggactggcacgcgcatcgttcatcccggctagagaaactggagctggacctgctgtaggatatgactaccaaagaag |
6138363 |
T |
 |
| Q |
301 |
tggacctcctgca |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6138364 |
tggacctcctgca |
6138376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University