View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20353_high_6 (Length: 274)
Name: NF20353_high_6
Description: NF20353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20353_high_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 11 - 274
Target Start/End: Original strand, 48812837 - 48813100
Alignment:
| Q |
11 |
cagagagttctagtgggaccttccagtgagcaagaacgcaggggtgagagagaacttgcagcttatgattggaaagctgaatggtaccctttgtacctca |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48812837 |
cagaaagttctagtgggaccttccagtgagcaagaacgcaggggtgagagagaacttgcagcttatgattggaaagaggaatggtaccctttgtacctca |
48812936 |
T |
|
| Q |
111 |
ctaagaatgtaccagatgatgcaccgttgggtctcacagtgtttgacaagaaccttgttttgtttaaagatggcaatgatcagtttcaatgctatgaaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48812937 |
ctaagaatgtaccagatgatgcaccgttgggtctcacagtatttgacaagaaccttgttttgtttaaagatggcaatgatcagtttcaatgctatgaaga |
48813036 |
T |
|
| Q |
211 |
tcggtgtcctcacaggttggttttaatttatctcgcttctaattattcttatgattgattttgc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48813037 |
tcggtgtcctcacaggttggttttaatttatctcgcttctaattattcttatgattgattttgc |
48813100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University