View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20353_low_7 (Length: 280)
Name: NF20353_low_7
Description: NF20353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20353_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 276
Target Start/End: Complemental strand, 51756533 - 51756276
Alignment:
| Q |
19 |
aatttattttctgatacttgaatatggaatattaattttatatacatgattgacaaaaagagatacagaaaaaatatacggagaattaattggttgctct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51756533 |
aatttattttctgatacttgaatatggaatattaattttatatacatgattgacaaaaagagatacagaaaaaatgtacggagaattaattggttgctct |
51756434 |
T |
 |
| Q |
119 |
atatcaacactttgcgttacaaatttgagtcccaaagagcatgaatgaggagaggattatatatcaacttatcatgatatatgttatccaaattaattaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51756433 |
atatcaacactttgcgttacaaatttgagagccaaagagcatgaatgaggagatgattatatatcaacttatcatgatatatattatccaaattaattaa |
51756334 |
T |
 |
| Q |
219 |
cccaccaccatatatacattgatgatagcaatattattataacatacctatgcttctc |
276 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
51756333 |
cccaccaccatatatacattgatgataacaatattattataacatacttatgtttctc |
51756276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University