View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20355_high_2 (Length: 258)
Name: NF20355_high_2
Description: NF20355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20355_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 242
Target Start/End: Complemental strand, 41458109 - 41457881
Alignment:
| Q |
14 |
aatatcagagtattgggtaggcttgcatttatcgggcgagttaaattctccagtgcaacaatactgtggctgattgaaagccgcacaagcactcttgcaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41458109 |
aatatcagagtattgggtaggcttgcatttatcgggcgagttaaattctccagtgcaacaatattgtggctgattgaaagccgcacaagcactcttgcaa |
41458010 |
T |
|
| Q |
114 |
gcaacaactttcccatcaggtcctttcatctgcaactctgtcgggcacacatcgttgatattcgcgggacaactcgagggtttgcaatcaccggttccac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41458009 |
gcaacaactttcccatcaggtcctttcatctgcaactctgtcgggcacacatcgttgatattcgcgggacaactcgagggtttgcaatcaccggttccac |
41457910 |
T |
|
| Q |
214 |
cttgtggaacaatggacatgggtacgttg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41457909 |
cttgtggaacaatggacatgggtacgttg |
41457881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University