View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20356_high_3 (Length: 223)
Name: NF20356_high_3
Description: NF20356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20356_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 179
Target Start/End: Complemental strand, 8712887 - 8712722
Alignment:
| Q |
14 |
gaagaagaagaagtttagagtgtttgtgtcacagtattaggttttatattttcccttcnnnnnnngggtacaatactaggctatgatactgacgtcacag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8712887 |
gaagaagaagaagtttagagtgtttgtgtcacagtattaggttttatattttcccttctttttttgggtacaatactaggctatgatactgacgtcacag |
8712788 |
T |
 |
| Q |
114 |
agtgttgttattttattggtaaaaatatgttttgataggtttcattcatactccctcttgtcctaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8712787 |
agtgttgttattttattggtaaaaatatgttttgataggtttcattcatactccctcttgtcctaa |
8712722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University