View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20357_high_11 (Length: 235)
Name: NF20357_high_11
Description: NF20357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20357_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 217
Target Start/End: Original strand, 18823605 - 18823804
Alignment:
| Q |
18 |
attaatagtgcaaataaagcctctaaaaatttcttgctaaatatatggagtaagcagccaatacatccagggactacggcaattcacacattcagagatc |
117 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
18823605 |
attaatagtgcaaataaaacctcttaaaatttcttgctaaatatatggagtaagcagccaatccattcagggactacaacaattcacacatccagagatc |
18823704 |
T |
|
| Q |
118 |
taaatatatgggacctaaaccaaaagctttcaactgcttggcaacaatatttgtctgcgatactctttgggggagaagagcttctgtttttggacgataa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18823705 |
taaatatatgggacctaaaccaaaagctttcaactgcttggcaacaatatttgtctgcgatactctttgggggagaagagcttctgtttttggacaataa |
18823804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 47 - 173
Target Start/End: Complemental strand, 49722083 - 49721951
Alignment:
| Q |
47 |
tttcttgctaaatatatggagtaagcagccaatacatccagggactacg------gcaattcacacattcagagatctaaatatatgggacctaaaccaa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
49722083 |
tttcttgctaaatatatggagtaagcagccaatacattcagggactataacaatagcaattcacacatacagggatctaaatatatgggacctaaaccaa |
49721984 |
T |
|
| Q |
141 |
aagctttcaactgcttggcaacaatatttgtct |
173 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||| |
|
|
| T |
49721983 |
aagctttaaactgcttggcaacagtatttgtct |
49721951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University