View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20357_high_13 (Length: 203)
Name: NF20357_high_13
Description: NF20357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20357_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 11988588 - 11988413
Alignment:
| Q |
17 |
taaactgcccacgatatttaggatggcaaaatgggtttgattcgccggctgatctgtttagcttgctaatttttacgaattgagttggaactttgaactt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
11988588 |
taaactgcccacgatatttaggatggcaaaatgggtttgattcgccggctgatctgtttagctcgttaatttttacgaattgagttggaactttgaactt |
11988489 |
T |
|
| Q |
117 |
gttccatctagtttgttgaaaaaacagggcggaacgattgacccatgagttacataaaagatttctattgtttctt |
192 |
Q |
| |
|
||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11988488 |
gtttcatcttgtttgttgaaaaaacaggacggaacgattgacccatgagttacataaaagatttctattgtttctt |
11988413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University