View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20357_high_4 (Length: 333)
Name: NF20357_high_4
Description: NF20357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20357_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 162 - 315
Target Start/End: Complemental strand, 37573093 - 37572939
Alignment:
| Q |
162 |
gttaacattttcaaatgatgaatacacg-agcactagtactatatatagtctcatcacataacattttcatgcaaccttttcttcttcttcacactctca |
260 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37573093 |
gttaacattttcaaatgatgaatacacgtagcactagtactatatatagtctcatcacataacattttcatgcaaccttttcttcttcttcacactctca |
37572994 |
T |
 |
| Q |
261 |
tcactttcaatggacccaaattcacactcaatcttttccggtgacaccaccgtag |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37572993 |
tcactttcaatggacccaaattcacactcaatcttttccggtgacaccaccgtag |
37572939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 151
Target Start/End: Complemental strand, 37573164 - 37573135
Alignment:
| Q |
122 |
atgtatgtgtgtgatgatatgcttataata |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37573164 |
atgtatgtgtgtgatgatatgcttataata |
37573135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University