View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20357_high_6 (Length: 314)
Name: NF20357_high_6
Description: NF20357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20357_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 3 - 293
Target Start/End: Original strand, 16922841 - 16923132
Alignment:
| Q |
3 |
agcaaccatgaagatgatgatgaagtaagattccctagccaaatttatttaacaaaacgatattaataatcattttacaaccgttgtcgatgagacttaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16922841 |
agcaaccatgaagatgatgatgaagtaagattccctagccaaatttatttaacaaaacgatattaataatcattttacaaccgttgtcgatgagacttaa |
16922940 |
T |
|
| Q |
103 |
actttaaccctagactccgaaatgttcaacttactttagtcaatnnnnnnnntaccacatcactttcaaac-nnnnnnnnccttttcaattatttgatgg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
16922941 |
actttaaccctagactccgaaatgttcaacttactttagtcaataaaaaaaataccacatcactttcaagctttttttttccttttcaattatttgatgg |
16923040 |
T |
|
| Q |
202 |
tataattctttaatctaaaattcctttcattttgtacttgcagatagctgttaaagaagaagatgatatggttgattcctcagatatctttg |
293 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16923041 |
tataattctttaatttaagattcctttcattttgtacttgcagatagctgttaaagaagaagatgatatggttgattcctcagatatctttg |
16923132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 254 - 293
Target Start/End: Original strand, 32555865 - 32555904
Alignment:
| Q |
254 |
aaagaagaagatgatatggttgattcctcagatatctttg |
293 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
32555865 |
aaagaggaagatgatatggttgattcctcagatatatttg |
32555904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University