View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20357_low_3 (Length: 341)
Name: NF20357_low_3
Description: NF20357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20357_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 5 - 327
Target Start/End: Original strand, 30788875 - 30789196
Alignment:
| Q |
5 |
gaggaggagcagagatggtctctaactggaatgacagcacttgttaccggtggcactcgtggaatcgggttttcatctttctccttttccgttatttcat |
104 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30788875 |
gaggagga-cagagatggtctctaactggaatgacagcacttgttaccggtggcactcgtggaatcgggttttcatctttctccttttcccttatttcat |
30788973 |
T |
 |
| Q |
105 |
tgtttatcttatcttcaacaccctgcatcattattcatatgtagtctttattttgatctagccaaaaatacttcattatcttttacactctccgttttaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30788974 |
tgtttatcttatcttcaacaccctgcatcattattcatatgtagtctttattttgatctagccaaaaatacttcattatcttttacactctccgttttaa |
30789073 |
T |
 |
| Q |
205 |
gattagtgtcgtttaaaggtttttgcacacggactaacactgcaacataattgagatctagttacatttgaacaattgttaggtattactaaagagcttt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30789074 |
gattagtgtcgtttaaaggtttttgcacacggactaacactgcaacataattgagatctagttacatttggacaattgttaggtattactaaagagcttt |
30789173 |
T |
 |
| Q |
305 |
agtaacattttaccaaagagatg |
327 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30789174 |
agtaacattttaccaaagagatg |
30789196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University