View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20358_high_2 (Length: 281)
Name: NF20358_high_2
Description: NF20358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20358_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 12 - 183
Target Start/End: Complemental strand, 1505314 - 1505143
Alignment:
| Q |
12 |
tactataaaatttagtctcgaaccttcaaaaatataaaatttcatttgataaaataggttcaaattatactatttttgaattaaaattaatatttaacta |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
1505314 |
tactataaaatttagtctcaaaccttcaaaaatataaaatttcatttgataaaataggctcaaattctactatttttgaattaaaattaatatgtaacta |
1505215 |
T |
 |
| Q |
112 |
atattgtttcaatcctttcaacnnnnnnncccttcaaacaaaatcctctagaaggaaaaactaatatttttt |
183 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1505214 |
atattgtttcaatcctttcaacaaaaaaacccttcaaacaaaatcctctagaaggaaaaactaatatttttt |
1505143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University