View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20358_low_3 (Length: 226)
Name: NF20358_low_3
Description: NF20358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20358_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 57 - 211
Target Start/End: Original strand, 39499161 - 39499315
Alignment:
| Q |
57 |
ttttatttttactataatgtatggatgaaagaaattgaagaataatggtggggttgagtttaagtatttaaattaatgattcttgttggaaagagttggt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39499161 |
ttttatttttactataatgtatggatgaaagaaattgaagaataatggtggggttgagtttaagtatttaaattaatgattcttgttggaaagagttggt |
39499260 |
T |
 |
| Q |
157 |
tgtgctaattcatgaagaaaaggagagaataaactcaacattagaaagtggtatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39499261 |
tgtgctaattcatgaagaaaaggagagaataaactcaacattagaaagtggtatt |
39499315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 57
Target Start/End: Original strand, 39499109 - 39499145
Alignment:
| Q |
21 |
cccctaatccaaccttacctatcttcatcttcttctt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39499109 |
cccctaatccaaccttacctatcttcatcttattctt |
39499145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University